circad | circRNAs associated with diseases

hsa_circRNA_104075
Gene	NUP153	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	28710406
Experimental Method
Sample Type	Tissues	Comparison	4 pair of snap-frozen Hepatocelluar Carcinoma (HCC) tissue and matched para-carcinoma tissue
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAAGATGTCAAGCCCTTTAGC Reverse GAGTTGCTTAGCTTTCATTTGTC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Huang, XY, Huang, ZL, Xu, YH, Zheng, Q, Chen, Z, Song, W, Zhou, J, Tang, ZY, Huang, XY (2017). Comprehensive circular RNA profiling reveals the regulatory role of the circRNA-100338/miR-141-3p pathway in hepatitis B-related hepatocellular carcinoma. Sci Rep, 7, 1:5428.